MirGeneDB

MirGeneDB ID

Asu-Mir-279-o28

Family name MIR-279 (all species)
Seed GACUAGA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-279a
Paralogues Asu-Mir-279-o26  Asu-Mir-279-o27  Asu-Mir-279-o29  Asu-Mir-279-o30 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold287: 267836-267891 [-]
Clustered MiRNAs
(< 10kb from Mir-279-o28)
Mir-791 Scaffold287: 265477-265534 [-]
Mir-2-o59 Scaffold287: 267253-267310 [-]
Mir-2-P11 Scaffold287: 267429-267487 [-]
Mir-279-o28 Scaffold287: 267836-267891 [-]
Precursor
(pre-Mir +30nt flank)
UCACAUCGUGCUGCAUUGCCACAUUCUUUGCUGGGCAUGGCUCUAUGUCAUGCUAUCUAGUUUCAUGACUAGAUCCAUACUCAGCUAGGGGUGUGGCUCAGGCAGCUACGUUUAGA
Get precursor sequence
Structure
        10          20        30        40        50        
UCACAUCGUGCUGCAUU--|          U      C    C    U      CUAUC 
                   GCCACAUUCUU GCUGGG AUGG UCUA GUCAUG     \
                   CGGUGUGGGGA CGACUC UACC AGAU CAGUAC     U
AGAUUUGCAUCGACGGACU^          U      A    U    -      UUUGA 
    110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-279-o28_5p*

MirBase accessionMIMAT0021511
Sequence
0- CUGGGCAUGGCUCUAUGUCAUG -22
Get sequence
Mature sequence

Asu-Mir-279-o28_3p

MirBase accessionMIMAT0021512
Sequence
35- UGACUAGAUCCAUACUCAGCU -56
Get sequence