MirGeneDB

MirGeneDB ID

Asu-Mir-279-o27

Family name MIR-279 (all species)
Seed CUGGAUG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-44b
Paralogues Asu-Mir-279-o26  Asu-Mir-279-o28  Asu-Mir-279-o29  Asu-Mir-279-o30 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold187: 164312-164371 [-]
Clustered MiRNAs
(< 10kb from Mir-279-o27)
Mir-2-o60 Scaffold187: 163929-163989 [-]
Mir-279-o27 Scaffold187: 164312-164371 [-]
Precursor
(pre-Mir +30nt flank)
CAACUUUGCUUUGAAACGCUGCAGUAAGCUACUGGAUGUGUGUCAUAGUCAUGACGUGUGAUCAACAUGACUAGAUAUCACAUUCAGUGGUAUAUUUCAGCGCUACGCCAUUCCUGAUGA
Get precursor sequence
Structure
        10          20        30        40         50         
CAACUUUGCUUUGAAAC--    C    A             -|   A        ACGUG 
                   GCUG AGUA GCUACUGGAUGUG UGUC UAGUCAUG     U
                   CGAC UUAU UGGUGACUUACAC AUAG AUCAGUAC     G
AGUAGUCCUUACCGCAUCG    U    A             U^   -        AACUA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-279-o27_5p

MirBase accessionMIMAT0021564
Sequence
0- ACUGGAUGUGUGUCAUAGUCAUG -23
Get sequence
Star sequence

Asu-Mir-279-o27_3p*

MirBase accessionMIMAT0021565
Sequence
37- UGACUAGAUAUCACAUUCAGUGG -60
Get sequence