MirGeneDB

MirGeneDB ID

Asu-Mir-216-P2

Family name MIR-216 (all species)
Seed AAUAUCA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-283
Paralogues Asu-Mir-216-P1 
Orthologues Aae-Mir-216-P2  Bge-Mir-216-P2  Cgi-Mir-216-P2  Cte-Mir-216-P2  Dan-Mir-216-P2  Dme-Mir-216-P2  Dmo-Mir-216-P2  Dpu-Mir-216-P2  Efe-Mir-216-P2a  Efe-Mir-216-P2b  Hme-Mir-216-P2  Lan-Mir-216-P2a  Lan-Mir-216-P2b  Lgi-Mir-216-P2  Tca-Mir-216-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold36: 852176-852234 [+]
Clustered MiRNAs
(< 10kb from Mir-216-P2)
Mir-216-P2 Scaffold36: 852176-852234 [+]
Mir-216-P1 Scaffold36: 852366-852422 [+]
Precursor
(pre-Mir +30nt flank)
UGUAGCCGUCAGUUGAUGACUGCUCAAGGAGAAUAUCAGCAAGAUUGAUCUGGCUGUAUAUAAGUCCAGACCUAUCUGUCGAUAUUGCCUGCGGGCAGCUGCCUCUGCCUUAUUCCAAC
Get precursor sequence
Structure
        10          20         30        40        50         
UGUAGCCGUCAGUUGAUGA--      A-|  AG      A   A   UGA     CUGUA 
                     CUGCUC  AGG  AAUAUC GCA GAU   UCUGG     U
                     GACGGG  UCC  UUAUAG UGU CUA   AGACC     A
CAACCUUAUUCCGUCUCCGUC      CG^  G-      C   -   UCC     UGAAU 
       110       100        90         80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-216-P2_5p

MirBase accessionMIMAT0021519
Sequence
0- GAAUAUCAGCAAGAUUGAUCUGG -23
Get sequence
Star sequence

Asu-Mir-216-P2_3p*

MirBase accessionMIMAT0021520
Sequence
37- AGACCUAUCUGUCGAUAUUGCC -59
Get sequence