MirGeneDB

MirGeneDB ID

Asu-Mir-2-o62c

Family name MIR-2 (all species)
Seed AUCACAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-43c-2
Paralogues Asu-Mir-2-o58a  Asu-Mir-2-o58b  Asu-Mir-2-o59  Asu-Mir-2-o60  Asu-Mir-2-o61  Asu-Mir-2-o62a  Asu-Mir-2-o62b  Asu-Mir-2-o62d  Asu-Mir-2-P11 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold1171: 26596-26653 [+]
Precursor
(pre-Mir +30nt flank)
UACCGGCGAAACCAGGUGUGUACAGCGGCGCGUGGCAAAGAUACUGCGAUGCGCCGCGUUACAUCGUAUCACAGUUCUUUGUCACCCUUUGCCUUACGCAUAUUUUCCACAAAACCAU
Get precursor sequence
Structure
        10          20        30        40        50         
UACCGGCGAAACCAGGU--|    CA    CGC          U    C      CCGCG 
                   GUGUA  GCGG   GUGGCAAAGA ACUG GAUGCG     \
                   CGCAU  CGUU   CACUGUUUCU UGAC CUAUGC     U
UACCAAAACACCUUUUAUA^    UC    UCC          -    A      UACAU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-2-o62c_5p* (predicted)

MirBase accessionMIMAT0022671
Sequence
0- CGUGGCAAAGAUACUGCGAUGCG -23
Get sequence
Mature sequence

Asu-Mir-2-o62c_3p

MirBase accessionMIMAT0021454
Sequence
36- UAUCACAGUUCUUUGUCACCCU -58
Get sequence