MirGeneDB

MirGeneDB ID

Asu-Mir-2-o62b

Family name MIR-2 (all species)
Seed AUCACAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-43c-1
Paralogues Asu-Mir-2-o58a  Asu-Mir-2-o58b  Asu-Mir-2-o59  Asu-Mir-2-o60  Asu-Mir-2-o61  Asu-Mir-2-o62a  Asu-Mir-2-o62c  Asu-Mir-2-o62d  Asu-Mir-2-P11 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold919: 52009-52066 [+]
Clustered MiRNAs
(< 10kb from Mir-2-o62b)
Mir-2-o62b Scaffold919: 52009-52066 [+]
Mir-279-o30 Scaffold919: 52254-52311 [+]
Precursor
(pre-Mir +30nt flank)
GUAUCGCGAAGCCCGGUGCGUACAGCAGCGCGUGGCAAGGAUACUGCGAUGCGUCAUGUUGCAUCGUAUCACAGUUCUUUGUCACCCUUUGCAUCACGCAUAUCCUGCGAUGCGUCGU
Get precursor sequence
Structure
        10          20        30        40        50         
GUAUCGCGAAGCCCGGU--|   ACA    CGC          U    C      UCAUG 
                   GCGU   GCAG   GUGGCAAGGA ACUG GAUGCG     \
                   CGCA   CGUU   CACUGUUUCU UGAC CUAUGC     U
UGCUGCGUAGCGUCCUAUA^   CUA    UCC          -    A      UACGU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-2-o62b_5p* (predicted)

MirBase accessionMIMAT0021453
Sequence
0- CGUGGCAAGGAUACUGCGAUGCG -23
Get sequence
Mature sequence

Asu-Mir-2-o62b_3p

MirBase accessionMIMAT0021454
Sequence
36- UAUCACAGUUCUUUGUCACCCU -58
Get sequence