MirGeneDB

MirGeneDB ID

Asu-Mir-2-o61

Family name MIR-2 (all species)
Seed AUCACAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-43a
Paralogues Asu-Mir-2-o58a  Asu-Mir-2-o58b  Asu-Mir-2-o59  Asu-Mir-2-o60  Asu-Mir-2-o62a  Asu-Mir-2-o62b  Asu-Mir-2-o62c  Asu-Mir-2-o62d  Asu-Mir-2-P11 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold800: 98049-98111 [-]
Clustered MiRNAs
(< 10kb from Mir-2-o61)
Mir-5350-P6 Scaffold800: 97547-97610 [-]
Mir-279-o26 Scaffold800: 97897-97956 [-]
Mir-2-o61 Scaffold800: 98049-98111 [-]
Mir-36-o28 Scaffold800: 98613-98672 [-]
Precursor
(pre-Mir +30nt flank)
AGUUUAGACGUAGUCGGAGUCGGACCCGGCGAUAGUAAGUACUGCGAUAUGCUGCAAGAACACAAACACAUAUCACAGUCUACUUGCUGUCUCCGGUUCGCUGACUGACUCAACGAAGAAAGU
Get precursor sequence
Structure
        10        20          30        40          50          
AGUUUAGACGUAGUCGGA     AC--    C          --|   C      CUGCAAGA 
                  GUCGG    CCGG GAUAGUAAGU  ACUG GAUAUG        \
                  CAGUC    GGCC CUGUCGUUCA  UGAC CUAUAC        A
UGAAAGAAGCAACUCAGU     GCUU    U          UC^   A      ACAAACAC 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-2-o61_5p*

MirBase accessionMIMAT0021449
Sequence
0- GAUAGUAAGUACUGCGAUAUG -21
Get sequence
Mature sequence

Asu-Mir-2-o61_3p

MirBase accessionMIMAT0021450
Sequence
40- UAUCACAGUCUACUUGCUGUCUC -63
Get sequence