MirGeneDB

MirGeneDB ID

Asu-Mir-2-o60

Family name MIR-2 (all species)
Seed AUCACAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-43d
Paralogues Asu-Mir-2-o58a  Asu-Mir-2-o58b  Asu-Mir-2-o59  Asu-Mir-2-o61  Asu-Mir-2-o62a  Asu-Mir-2-o62b  Asu-Mir-2-o62c  Asu-Mir-2-o62d  Asu-Mir-2-P11 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold187: 163929-163989 [-]
Clustered MiRNAs
(< 10kb from Mir-2-o60)
Mir-2-o60 Scaffold187: 163929-163989 [-]
Mir-279-o27 Scaffold187: 164312-164371 [-]
Precursor
(pre-Mir +30nt flank)
GAGGUAAACCUAGGCAGCUUUAGUGGCAGUAACCCGAUGUGGCUGCGAUACUGUUUGCACAUGGCCGAGUAUCACAGUCUUAUCCGGUCACCGCCUCUUCGGCUCUCCUACUCACAUUCCC
Get precursor sequence
Structure
        10          20        30        40        50          
GAGGUAAACCUAGGCAG--| UU  U   A  A   C    U     C      GUUUGCA 
                   CU  AG GGC GU ACC GAUG GGCUG GAUACU       \
                   GG  UC CCG CA UGG CUAU CUGAC CUAUGA       C
CCCUUACACUCAUCCUCUC^ CU  U   C  C   C    U     A      GCCGGUA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-2-o60_5p*

MirBase accessionMIMAT0021433
Sequence
0- AACCCGAUGUGGCUGCGAUACU -22
Get sequence
Mature sequence

Asu-Mir-2-o60_3p

MirBase accessionMIMAT0021434
Sequence
39- UAUCACAGUCUUAUCCGGUCAC -61
Get sequence