MirGeneDB

MirGeneDB ID

Asu-Mir-2-o59

Family name MIR-2 (all species)
Seed AUCACAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-2b
Paralogues Asu-Mir-2-o58a  Asu-Mir-2-o58b  Asu-Mir-2-o60  Asu-Mir-2-o61  Asu-Mir-2-o62a  Asu-Mir-2-o62b  Asu-Mir-2-o62c  Asu-Mir-2-o62d  Asu-Mir-2-P11 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold287: 267253-267310 [-]
Clustered MiRNAs
(< 10kb from Mir-2-o59)
Mir-791 Scaffold287: 265477-265534 [-]
Mir-2-o59 Scaffold287: 267253-267310 [-]
Mir-2-P11 Scaffold287: 267429-267487 [-]
Mir-279-o28 Scaffold287: 267836-267891 [-]
Precursor
(pre-Mir +30nt flank)
CCGUGACCCGUUGAAUUGUGAACUCUGGCGUGCUUAAUCGUUCAGUGAUUCAUAGUGAAUAGCUUGUAUCACAGUUCGAUUUGGCCCGCUAGUGUCACUGCUGCGUCCUCACGUAAUU
Get precursor sequence
Structure
        10           20        30        40        50        
CCGUGACCCGUUGAAUU---|   ACU      U   U     UUCA     U  UAGUG 
                    GUGA   CUGGCG GCU AAUCG    GUGAU CA     A
                    CACU   GAUCGC CGG UUAGC    CACUA GU     A
UUAAUGCACUCCUGCGUCGU^   GU-      C   U     UUGA     U  UCGAU 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-2-o59_5p*

MirBase accessionMIMAT0021427
Sequence
0- UGCUUAAUCGUUCAGUGAUUCA -22
Get sequence
Mature sequence

Asu-Mir-2-o59_3p

MirBase accessionMIMAT0021428
Sequence
36- UAUCACAGUUCGAUUUGGCCCG -58
Get sequence