MirGeneDB

MirGeneDB ID

Asu-Mir-2-o58a

Family name MIR-2 (all species)
Seed AUCACAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-2a
Paralogues Asu-Mir-2-o58b  Asu-Mir-2-o59  Asu-Mir-2-o60  Asu-Mir-2-o61  Asu-Mir-2-o62a  Asu-Mir-2-o62b  Asu-Mir-2-o62c  Asu-Mir-2-o62d  Asu-Mir-2-P11 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold65: 285241-285298 [+]
Clustered MiRNAs
(< 10kb from Mir-2-o58a)
Mir-71 Scaffold65: 284611-284668 [+]
Mir-2-o58a Scaffold65: 285241-285298 [+]
Precursor
(pre-Mir +30nt flank)
GAUGUCGACGGGCACAAGGCCGUUCCAGCACGUCAAAGUGGUGGUGAUUUGUUGUGGAUAAGCUCAUAUCACAGCCAGCUUUGAUGUGCUGUGGCAGUCAAUCGUUGCCUCACUCGUC
Get precursor sequence
Structure
        10          20        30         40        50        
GAUGUCGACGGGCACAA--   C  UC             -|   G     U  UUGUGG 
                   GGC GU  CAGCACGUCAAAG UGGU GUGAU UG      \
                   CUG CG  GUCGUGUAGUUUC ACCG CACUA AC      A
CUGCUCACUCCGUUGCUAA   A  GU             G^   A     U  UCGAAU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-2-o58a_5p*

MirBase accessionMIMAT0021425
Sequence
0- CGUCAAAGUGGUGGUGAUUUG -21
Get sequence
Mature sequence

Asu-Mir-2-o58a_3p

MirBase accessionMIMAT0021426
Sequence
36- UAUCACAGCCAGCUUUGAUGUG -58
Get sequence