MirGeneDB

MirGeneDB ID

Asu-Mir-2-P11

Family name MIR-2 (all species)
Seed AUCACAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-250
Paralogues Asu-Mir-2-o58a  Asu-Mir-2-o58b  Asu-Mir-2-o59  Asu-Mir-2-o60  Asu-Mir-2-o61  Asu-Mir-2-o62a  Asu-Mir-2-o62b  Asu-Mir-2-o62c  Asu-Mir-2-o62d 
Orthologues Cbr-Mir-2-o11  Cbr-Mir-2-P11  Cel-Mir-2-o11  Cel-Mir-2-P11 
Node of Origin (locus) Chromadorea
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold287: 267429-267487 [-]
Clustered MiRNAs
(< 10kb from Mir-2-P11)
Mir-791 Scaffold287: 265477-265534 [-]
Mir-2-o59 Scaffold287: 267253-267310 [-]
Mir-2-P11 Scaffold287: 267429-267487 [-]
Mir-279-o28 Scaffold287: 267836-267891 [-]
Precursor
(pre-Mir +30nt flank)
UAGCAUAAUCGCGAUAAUGGACGGCAUCUAACUGGCAGUUGACUGUUGAUCCGUCGUAUCGAAUCGAAUCACAGCCAAACUGUUGGUUAGGUUCAGUUCGUUUGUUCAUCCAAUAUCGC
Get precursor sequence
Structure
        10          20        30        40         50         
UAGCAUAAUCGCGAUAA--     GGC       UG      GA-|   U   C  UCGUA 
                   UGGAC   AUCUAAC  GCAGUU   CUGU GAU CG     \
                   GCUUG   UGGAUUG  UGUCAA   GACA CUA GC     U
CGCUAUAACCUACUUGUUU     ACU       GU      ACC^   -   A  UAAGC 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-2-P11_5p*

MirBase accessionMIMAT0021507
Sequence
0- ACUGGCAGUUGACUGUUGAUCCG -23
Get sequence
Mature sequence

Asu-Mir-2-P11_3p

MirBase accessionMIMAT0021508
Sequence
36- AAUCACAGCCAAACUGUUGGUUA -59
Get sequence