MirGeneDB

MirGeneDB ID

Asu-Mir-190

Family name MIR-190 (all species)
Seed GAUAUGU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-50
Paralogues
Orthologues Aae-Mir-190  Aca-Mir-190-P1  Aca-Mir-190-P2  Ami-Mir-190-P1  Ami-Mir-190-P2  Bfl-Mir-190  Bge-Mir-190  Bta-Mir-190-P1  Bta-Mir-190-P2  Cbr-Mir-190  Cel-Mir-190  Cfa-Mir-190-P1  Cfa-Mir-190-P2  Cgi-Mir-190  Cli-Mir-190-P1  Cpi-Mir-190-P1  Cpi-Mir-190-P2  Cpo-Mir-190-P1  Cpo-Mir-190-P2  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P1  Dno-Mir-190-P2  Dpu-Mir-190  Dre-Mir-190-P1  Dre-Mir-190-P2  Efe-Mir-190-P3  Efe-Mir-190-P4  Efe-Mir-190-P5  Efe-Mir-190-P6  Ete-Mir-190-P1  Ete-Mir-190-P2  Gga-Mir-190-P1  Gga-Mir-190-P2  Hme-Mir-190  Hsa-Mir-190-P1  Hsa-Mir-190-P2  Isc-Mir-190  Lan-Mir-190-P7  Lan-Mir-190-P8  Lgi-Mir-190-v1  Lgi-Mir-190-v2  Mdo-Mir-190-P1  Mdo-Mir-190-P2  Mml-Mir-190-P1  Mml-Mir-190-P2  Mmu-Mir-190-P1  Mmu-Mir-190-P2  Oan-Mir-190-P1  Oan-Mir-190-P2  Ocu-Mir-190-P1  Ocu-Mir-190-P2  Pfl-Mir-190  Pmi-Mir-190  Rno-Mir-190-P1a  Rno-Mir-190-P1b  Rno-Mir-190-P2  Sha-Mir-190-P1  Sha-Mir-190-P2  Sko-Mir-190  Sto-Mir-190-P1  Sto-Mir-190-P2  Tca-Mir-190  Tgu-Mir-190-P1  Tgu-Mir-190-P2  Xtr-Mir-190-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold592: 443185-443243 [-]
Precursor
(pre-Mir +30nt flank)
CUACCCAUUGGGCACAUGCUUGUGCGGCGUUGAUAUGUCUGGUAUUCUUGGGUUGGGUCUUCGUCAACCAGUAUCUCAGACGUAUCAUCGUUGUGCAUUGCGCCGUGCAUCGUCACUUG
Get precursor sequence
Structure
        10         20         30        40        50          
CUACCCAUUGGGCACAU-  U-| UG     U           GU  UCUUG    GGGUC 
                  GC  UG  CGGCG UGAUAUGUCUG  AU     GGUU     \
                  CG  AC  GUUGC ACUAUGCAGAC  UA     CCAA     U
GUUCACUGCUACGUGCCG  UU^ GU     U           UC  UGA--    CUGCU 
       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-190_5p

MirBase accessionMIMAT0021461
Sequence
0- UGAUAUGUCUGGUAUUCUUGGGUU -24
Get sequence
Star sequence

Asu-Mir-190_3p*

MirBase accessionMIMAT0021462
Sequence
37- CCAGUAUCUCAGACGUAUCAUC -59
Get sequence