MirGeneDB

MirGeneDB ID

Asu-Mir-133

Family name MIR-133 (all species)
Seed CUGGUUG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-133
Paralogues
Orthologues Aae-Mir-133  Aca-Mir-133-P1-v1  Aca-Mir-133-P1-v2  Aca-Mir-133-P2-v1  Aca-Mir-133-P2-v2  Aca-Mir-133-P3-v1  Aca-Mir-133-P3-v2  Aca-Mir-133-P4-v1  Aca-Mir-133-P4-v2  Ami-Mir-133-P1-v1  Ami-Mir-133-P1-v2  Ami-Mir-133-P2-v1  Ami-Mir-133-P2-v2  Ami-Mir-133-P3-v1  Ami-Mir-133-P3-v2  Ami-Mir-133-P4-v1  Ami-Mir-133-P4-v2  Bfl-Mir-133-v1  Bfl-Mir-133-v2  Bge-Mir-133  Bta-Mir-133-P1-v1  Bta-Mir-133-P1-v2  Bta-Mir-133-P2-v1  Bta-Mir-133-P2-v2  Bta-Mir-133-P3-v1  Bta-Mir-133-P3-v2  Cbr-Mir-133  Cel-Mir-133  Cfa-Mir-133-P1-v1  Cfa-Mir-133-P1-v2  Cfa-Mir-133-P2-v1  Cfa-Mir-133-P2-v2  Cfa-Mir-133-P3-v1  Cfa-Mir-133-P3-v2  Cgi-Mir-133-v1  Cgi-Mir-133-v2  Cin-Mir-133  Cli-Mir-133-P1-v1  Cli-Mir-133-P1-v2  Cli-Mir-133-P2-v1  Cli-Mir-133-P2-v2  Cli-Mir-133-P3-v1  Cli-Mir-133-P3-v2  Cli-Mir-133-P4-v1  Cli-Mir-133-P4-v2  Cpi-Mir-133-P1-v1  Cpi-Mir-133-P1-v2  Cpi-Mir-133-P2-v1  Cpi-Mir-133-P2-v2  Cpi-Mir-133-P3-v1  Cpi-Mir-133-P3-v2  Cpi-Mir-133-P4-v1  Cpi-Mir-133-P4-v2  Cpo-Mir-133-P1-v1  Cpo-Mir-133-P1-v2  Cpo-Mir-133-P2-v1  Cpo-Mir-133-P2-v2  Cpo-Mir-133-P3-v1  Cpo-Mir-133-P3-v2  Cte-Mir-133  Dan-Mir-133  Dme-Mir-133  Dmo-Mir-133  Dno-Mir-133-P1-v1  Dno-Mir-133-P1-v2  Dno-Mir-133-P2-v1  Dno-Mir-133-P2-v2  Dno-Mir-133-P3-v1  Dno-Mir-133-P3-v2  Dpu-Mir-133  Dre-Mir-133-P1-v1  Dre-Mir-133-P1-v2  Dre-Mir-133-P2-v1  Dre-Mir-133-P2-v2  Dre-Mir-133-P3a-v1  Dre-Mir-133-P3a-v2  Dre-Mir-133-P3b-v1  Dre-Mir-133-P3b-v2  Efe-Mir-133  Ete-Mir-133-P1-v1  Ete-Mir-133-P1-v2  Ete-Mir-133-P2-v1  Ete-Mir-133-P2-v2  Ete-Mir-133-P3-v1  Ete-Mir-133-P3-v2  Gga-Mir-133-P1-v1  Gga-Mir-133-P1-v2  Gga-Mir-133-P2-v1  Gga-Mir-133-P2-v2  Gga-Mir-133-P3-v1  Gga-Mir-133-P3-v2  Gga-Mir-133-P4-v1  Gga-Mir-133-P4-v2  Hme-Mir-133  Hsa-Mir-133-P1-v1  Hsa-Mir-133-P1-v2  Hsa-Mir-133-P2-v1  Hsa-Mir-133-P2-v2  Hsa-Mir-133-P3-v1  Hsa-Mir-133-P3-v2  Isc-Mir-133  Lan-Mir-133  Lgi-Mir-133  Mdo-Mir-133-P1-v1  Mdo-Mir-133-P1-v2  Mdo-Mir-133-P2-v1  Mdo-Mir-133-P2-v2  Mdo-Mir-133-P3-v1  Mdo-Mir-133-P3-v2  Mml-Mir-133-P1-v1  Mml-Mir-133-P1-v2  Mml-Mir-133-P2-v1  Mml-Mir-133-P2-v2  Mml-Mir-133-P3-v1  Mml-Mir-133-P3-v2  Mmu-Mir-133-P1-v1  Mmu-Mir-133-P1-v2  Mmu-Mir-133-P2-v1  Mmu-Mir-133-P2-v2  Mmu-Mir-133-P3-v1  Mmu-Mir-133-P3-v2  Oan-Mir-133-P1-v1  Oan-Mir-133-P1-v2  Oan-Mir-133-P2-v1  Oan-Mir-133-P2-v2  Oan-Mir-133-P3-v1  Oan-Mir-133-P3-v2  Oan-Mir-133-P4-v1  Oan-Mir-133-P4-v2  Ocu-Mir-133-P2-v1  Ocu-Mir-133-P2-v2  Ocu-Mir-133-P3-v1  Ocu-Mir-133-P3-v2  Pfl-Mir-133-v1  Pfl-Mir-133-v2  Pmi-Mir-133-P5a  Pmi-Mir-133-P5b  Rno-Mir-133-P1-v1  Rno-Mir-133-P1-v2  Rno-Mir-133-P2-v1  Rno-Mir-133-P2-v2  Rno-Mir-133-P3-v1  Rno-Mir-133-P3-v2  Sha-Mir-133-P1-v1  Sha-Mir-133-P1-v2  Sha-Mir-133-P2-v1  Sha-Mir-133-P2-v2  Sha-Mir-133-P3-v1  Sha-Mir-133-P3-v2  Sko-Mir-133-v1  Sko-Mir-133-v2  Spu-Mir-133  Sto-Mir-133-P1-v1  Sto-Mir-133-P1-v2  Sto-Mir-133-P2-v1  Sto-Mir-133-P2-v2  Sto-Mir-133-P4-v1  Sto-Mir-133-P4-v2  Tca-Mir-133  Tgu-Mir-133-P1-v1  Tgu-Mir-133-P1-v2  Tgu-Mir-133-P2-v1  Tgu-Mir-133-P2-v2  Tgu-Mir-133-P3-v1  Tgu-Mir-133-P3-v2  Tgu-Mir-133-P4-v1  Tgu-Mir-133-P4-v2  Xtr-Mir-133-P1-v1  Xtr-Mir-133-P1-v2  Xtr-Mir-133-P2-v1  Xtr-Mir-133-P2-v2  Xtr-Mir-133-P3-v1  Xtr-Mir-133-P3-v2  Xtr-Mir-133-P4-v1  Xtr-Mir-133-P4-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold592: 112478-112537 [-]
Precursor
(pre-Mir +30nt flank)
ACUAGAACGGCGAACUCUUCCGUUCACGUACCUGGUUGUAGCCGAGCCAAAUUGUGUUUAGUGUAUCAAUUGGUCCCCUUCAACCAGCUACGAAAAGCGCGAAUAUCAGAACCGUUCUUA
Get precursor sequence
Structure
        10        20          30        40        50        60
ACUAGAACGGCGAACUCU  -    CA-|   C       U  CC  G    A   UGUUU 
                  UC CGUU   CGUA CUGGUUG AG  GA CCAA UUG     A
                  AG GCGA   GCAU GACCAAC UC  CU GGUU AAC     G
AUUCUUGCCAAGACUAUA  C    AAA^   C       U  CC  -    -   UAUGU 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-133_5p

MirBase accessionMIMAT0021497
Sequence
0- CCUGGUUGUAGCCGAGCCAAAUUG -24
Get sequence
Co-mature sequence

Asu-Mir-133_3p

MirBase accessionMIMAT0021498
Sequence
38- AUUGGUCCCCUUCAACCAGCUA -60
Get sequence