MirGeneDB

MirGeneDB ID

Asu-Mir-10-P2o1

Family name MIR-10 (all species)
Seed ACCCGUA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-100a-1
Paralogues Asu-Mir-10-P1  Asu-Mir-10-P2o2  Asu-Mir-10-P2o3  Asu-Mir-10-P2o4  Asu-Mir-10-P2o5  Asu-Mir-10-P2o6  Asu-Mir-10-P3  Asu-Mir-10-P4 
Orthologues Aae-Mir-10-P2  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dpu-Mir-10-P2  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Sko-Mir-10-P2  Tca-Mir-10-P2 
Node of Origin (locus) A. suum
Node of Origin (family) Eumetazoa
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold883: 122323-122381 [+]
Clustered MiRNAs
(< 10kb from Mir-10-P2o1)
Mir-10-P2o4 Scaffold883: 121212-121269 [+]
Mir-10-P2o1 Scaffold883: 122323-122381 [+]
Precursor
(pre-Mir +30nt flank)
CUCGCGUUAUUAAAUUGGCGGCUGGCGGUAAACCCGUAGAUCCGAACUUGUGUUGUGUAUUUGGUAACGCAAUUCGCCUCUCGGGUGCAUCGCUGAUUAGCCGUUGAUAUCCCUUACAA
Get precursor sequence
Structure
        10        20            30        40        50          
CUCGCGUUAUUAAAUUGGCG   ----|     AA     U   UC    C       GUGUA 
                    GCU    GGCGGU  ACCCG AGA  CGAA UUGUGUU     \
                    CGA    UCGCUA  UGGGC UCU  GCUU AACGCAA     U
AACAUUCCCUAUAGUUGC--   UUAG^     CG     -   CC    -       UGGUU 
       110         100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUGUG in loop
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-10-P2o1_5p

MirBase accessionMIMAT0021487
Sequence
0- AACCCGUAGAUCCGAACUUGUGUU -24
Get sequence
Star sequence

Asu-Mir-10-P2o1_3p* (predicted)

MirBase accessionMIMAT0021488
Sequence
37- CGCAAUUCGCCUCUCGGGUGCA -59
Get sequence