MirGeneDB

MirGeneDB ID

Asu-Mir-1

Family name MIR-1 (all species)
Seed GGAAUGU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-1
Paralogues
Orthologues Aae-Mir-1  Aca-Mir-1-P1  Aca-Mir-1-P2  Aca-Mir-1-P3  Aca-Mir-1-P4  Ami-Mir-1-P1  Ami-Mir-1-P2  Ami-Mir-1-P3  Ami-Mir-1-P4  Bfl-Mir-1  Bge-Mir-1  Bta-Mir-1-P1  Bta-Mir-1-P2  Bta-Mir-1-P3  Cbr-Mir-1  Cel-Mir-1  Cfa-Mir-1-P1  Cfa-Mir-1-P2  Cfa-Mir-1-P3  Cgi-Mir-1  Cin-Mir-1  Cli-Mir-1-P1  Cli-Mir-1-P2  Cli-Mir-1-P3  Cli-Mir-1-P4  Cpi-Mir-1-P1  Cpi-Mir-1-P2  Cpi-Mir-1-P3  Cpi-Mir-1-P4  Cpo-Mir-1-P1  Cpo-Mir-1-P2  Cpo-Mir-1-P3  Cte-Mir-1  Dan-Mir-1  Dme-Mir-1  Dmo-Mir-1  Dno-Mir-1-P1  Dno-Mir-1-P2  Dno-Mir-1-P3  Dpu-Mir-1  Dre-Mir-1-P1  Dre-Mir-1-P2  Dre-Mir-1-P3a  Dre-Mir-1-P3b  Efe-Mir-1-P5  Efe-Mir-1-P6  Efe-Mir-1-P7  Efe-Mir-1-P8  Ete-Mir-1-P1  Ete-Mir-1-P2  Ete-Mir-1-P3  Gga-Mir-1-P1  Gga-Mir-1-P2  Gga-Mir-1-P3  Gga-Mir-1-P4  Hme-Mir-1  Hsa-Mir-1-P1  Hsa-Mir-1-P2  Hsa-Mir-1-P3  Isc-Mir-1  Lan-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P1  Mdo-Mir-1-P2  Mdo-Mir-1-P3  Mml-Mir-1-P1  Mml-Mir-1-P2  Mml-Mir-1-P3  Mmu-Mir-1-P1  Mmu-Mir-1-P2  Mmu-Mir-1-P3  Oan-Mir-1-P1  Oan-Mir-1-P2  Oan-Mir-1-P3  Oan-Mir-1-P4  Ocu-Mir-1-P1  Ocu-Mir-1-P2  Ocu-Mir-1-P3  Pfl-Mir-1  Pmi-Mir-1  Rno-Mir-1-P1  Rno-Mir-1-P2  Rno-Mir-1-P3  Sha-Mir-1-P1  Sha-Mir-1-P2  Sha-Mir-1-P3  Sko-Mir-1  Spu-Mir-1  Sto-Mir-1-P1  Sto-Mir-1-P2  Sto-Mir-1-P4  Tca-Mir-1  Tgu-Mir-1-P1  Tgu-Mir-1-P2  Tgu-Mir-1-P3  Xtr-Mir-1-P1  Xtr-Mir-1-P2  Xtr-Mir-1-P3  Xtr-Mir-1-P4 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold592: 89761-89822 [+]
Precursor
(pre-Mir +30nt flank)
GUCUUCCUCGACGGUAUGCUUCUGUUGCAUCGUACUUCUUUACAUCGCCAUACUGGUAUUUCAAAGAGCUAUGGAAUGUAAAGAAGUAUGUAGUUACUGAAGCAAAACCUUCGCACCGUUCG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GUCUUCCUCGACGGUAU--|    U  U  AU               CG     CUGGUAUU 
                   GCUUC GU GC  CGUACUUCUUUACAU  CCAUA        \
                   CGAAG CA UG  GUAUGAAGAAAUGUA  GGUAU        U
GCUUGCCACGCUUCCAAAA^    U  U  AU               A-     CGAGAAAC 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-1_5p*

MirBase accessionMIMAT0021423
Sequence
0- CGUACUUCUUUACAUCGCCAUA -22
Get sequence
Mature sequence

Asu-Mir-1_3p

MirBase accessionMIMAT0021424
Sequence
41- UGGAAUGUAAAGAAGUAUGUA -62
Get sequence