MirGeneDB

MirGeneDB ID

Asu-Let-7-P7

Family name LET-7 (all species)
Seed GAGGUAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-84
Paralogues Asu-Let-7-P5 
Orthologues Aae-Let-7  Bge-Let-7  Cbr-Let-7-P7  Cel-Let-7-P7  Cgi-Let-7  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Pfl-Let-7  Pmi-Let-7  Sko-Let-7  Spu-Let-7  Tca-Let-7 
Node of Origin (locus) Chromadorea
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold22: 2606662-2606720 [+]
Precursor
(pre-Mir +30nt flank)
UUGACGAGUUGGGCAAACUCUAAAGGCCGAUGAGGUAGUUUAUAAAGCUGCGAGUGUGUUUUCCUUCGCAGAUUUUAGGCUAUCUCGACAGCCUUGAUCAAUGCCUUCCCCACUCCUCU
Get precursor sequence
Structure
        10        20          30        40        50         
UUGACGAGUUGGGCAAACUCUA--|    CGA            UAAAG      GUGUG 
                        AAGGC   UGAGGUAGUUUA     CUGCGA     U
                        UUCCG   GCUCUAUCGGAU     GACGCU     U
UCUCCUCACCCCUUCCGUAACUAG^    ACA            UUUA-      UCCUU 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Let-7-P7_5p

MirBase accessionMIMAT0021477
Sequence
0- UGAGGUAGUUUAUAAAGCUGCGA -23
Get sequence
Co-mature sequence

Asu-Let-7-P7_3p

MirBase accessionMIMAT0021478
Sequence
37- GCAGAUUUUAGGCUAUCUCGAC -59
Get sequence