MirGeneDB

MirGeneDB ID

Asu-Let-7-P5

Family name LET-7 (all species)
Seed GAGGUAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-let-7
Paralogues Asu-Let-7-P7 
Orthologues Aae-Let-7  Bge-Let-7  Cbr-Let-7-P5  Cel-Let-7-P5  Cgi-Let-7  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Pfl-Let-7  Pmi-Let-7  Sko-Let-7  Spu-Let-7  Tca-Let-7 
Node of Origin (locus) Chromadorea
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold488: 2112674-2112739 [-]
Clustered MiRNAs
(< 10kb from Let-7-P5)
Let-7-P5 Scaffold488: 2112674-2112739 [-]
Mir-10-P2o2 Scaffold488: 2112876-2112933 [-]
Precursor
(pre-Mir +30nt flank)
AUAUUGAACAGCGCGGCAAGGUCUGCUCGUUGAGGUAGUAGGUUGUAUAGUUGCGAGCUGCAUCCUUUCGAGAAACUGUCCAGCCUGCUAGCUUGCCGCGCGGACCGACGCUCAUGUAAUGAGUUA
Get precursor sequence
Structure
        10         20        30        40        50        60   
AUAUUGAACAGCGCGGCAA-|      U  UU   G          U      GCGAGCUGCA 
                    GGUCUGC CG  GAG UAGUAGGUUG AUAGUU          \
                    CCAGGCG GC  UUC AUCGUCCGAC UGUCAA          U
AUUGAGUAAUGUACUCGCAG^      C  CG   G          C      AGAGCUUUCC 
    120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Let-7-P5_5p

MirBase accessionMIMAT0021417
Sequence
0- UGAGGUAGUAGGUUGUAUAGUU -22
Get sequence
Star sequence

Asu-Let-7-P5_3p*

MirBase accessionMIMAT0021418
Sequence
43- AACUGUCCAGCCUGCUAGCUUGC -66
Get sequence