MirGeneDB

MirGeneDB ID

Asu-Bantam-o4

Family name BANTAM (all species)
Seed GAGAUCA
Species Large roundworm (Ascaris suum)
MiRBase ID
Paralogues Asu-Bantam-o1  Asu-Bantam-o2  Asu-Bantam-o3 
Orthologues Aae-Bantam  Bge-Bantam  Cbr-Bantam-P4  Cel-Bantam-P4  Cgi-Bantam  Cte-Bantam  Dan-Bantam  Dme-Bantam  Dmo-Bantam  Dpu-Bantam  Hme-Bantam  Lan-Bantam  Lgi-Bantam  Tca-Bantam 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold20: 148295-148353 [+]
Clustered MiRNAs
(< 10kb from Bantam-o4)
Bantam-o3 Scaffold20: 144531-144589 [+]
Bantam-o2 Scaffold20: 148295-148353 [+]
Precursor
(pre-Mir +30nt flank)
CAGCGAUCGAUUAUCGGAGUCGUUCUCAAAACGGGUGUGCAUGCAGAUCAUGGUGUAAUAUAGCUCAUGAGAUCAUGCCACAUCUGUCUUGAAAGCCACUCCUUUCUUCCUUCUCGUUU
Get precursor sequence
Structure
        10          20        30         40        50         
CAGCGAUCGAUUAUCGG--   C   C    A        -|    CAGA     GUGUAA 
                   AGU GUU UCAA ACGGGUGU GCAUG    UCAUG      \
                   UCA CGA AGUU UGUCUACA CGUAC    AGUAC      U
UUUGCUCUUCCUUCUUUCC   C   A    C        C^    UAG-     UCGAUA 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Bantam-o4_5p*

MirBase accessionNone
Sequence
0- ACGGGUGUGCAUGCAGAUCAUG -22
Get sequence
Mature sequence

Asu-Bantam-o4_3p

MirBase accessionNone
Sequence
37- UGAGAUCAUGCCACAUCUGUCU -59
Get sequence