MirGeneDB

MirGeneDB ID

Asu-Bantam-o1

Family name BANTAM (all species)
Seed GAGAUCA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-81a
Paralogues Asu-Bantam-o2  Asu-Bantam-o3  Asu-Bantam-o4 
Orthologues Aae-Bantam  Bge-Bantam  Cbr-Bantam-P1a  Cbr-Bantam-P1b  Cel-Bantam-P1  Cgi-Bantam  Cte-Bantam  Dan-Bantam  Dme-Bantam  Dmo-Bantam  Dpu-Bantam  Hme-Bantam  Lan-Bantam  Lgi-Bantam  Tca-Bantam 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold406: 346015-346076 [+]
Precursor
(pre-Mir +30nt flank)
GUGUAAUUCAACGUGCACCGCACGGGCACUAGGCCUUCACUGUGAUCUGCAGAAUGCCUGUUAUACUGUCUGAGAUCAUUGUGAAAGCUAUUUGCCUUGCUUGUGGAUACACCGUCGACGUU
Get precursor sequence
Structure
        10           20        30        40        50        60 
GUGUAAUUCAACGUGCACC---|  C     CUA   C     U       G    AUGCCUG 
                      GCA GGGCA   GGC UUCAC GUGAUCU CAGA       \
                      CGU UCCGU   UCG AAGUG UACUAGA GUCU       U
UUGCAGCUGCCACAUAGGUGUU^  -     UUA   A     U       -    GUCAUAU 
120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Bantam-o1_5p*

MirBase accessionNone
Sequence
0- AGGCCUUCACUGUGAUCUGCAGA -23
Get sequence
Mature sequence

Asu-Bantam-o1_3p

MirBase accessionMIMAT0021474
Sequence
40- UGAGAUCAUUGUGAAAGCUAUU -62
Get sequence