MirGeneDB

Gene name

Aca-Mir-216-P1b

Family name MIR-216 (all species)
MiRBase ID aca-mir-216b
Paralogues Aca-Mir-216-P1a 
Orthologues Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bta-Mir-216-P1b  Cel-Mir-216-P1  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1b  Cpi-Mir-216-P1b  Cpo-Mir-216-P1b  Dme-Mir-216-P1  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1b  Gga-Mir-216-P1b  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lgi-Mir-216-P1  Mdo-Mir-216-P1b  Mml-Mir-216-P1b  Mmu-Mir-216-P1b  Ocu-Mir-216-P1b  Rno-Mir-216-P1b  Sha-Mir-216-P1b  Tca-Mir-216-P1 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(AnoCar2)
scaffold_124.1-3925086: 640292-640354 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUGGCCGAAAUCAAAGUCACAGACUGAGAAAUCUCUGCAGGCAAAUGUGAUGUCUUGACCAGCAAUCUCACAGUUACCAGCAGAGGUUCUGCAAUCUGGACUGCUACGGUUAACUGACAUG
Get precursor sequence
Structure
        10           20         30        40        50        60 
UUGUGGCCGAAAUCAAA---|  A    C  -    A       A  C  A     UGUCUUGA 
                    GUC CAGA UG AGAA UCUCUGC GG AA UGUGA        \
                    CAG GUCU AC UCUU GGAGACG CC UU ACACU        C
GUACAGUCAAUUGGCAUCGU^  -    A  G    -       A  A  G     CUAACGAC 
 120       110        100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-216-P1b_5p

MirBase accessionMIMAT0021876
Sequence
0- AAAUCUCUGCAGGCAAAUGUGA -22
Get sequence
Seed sequenceAAUCUCU
Star sequence

Aca-Mir-216-P1b_3p*

MirBase accessionMIMAT0021877
Sequence
41- ACAGUUACCAGCAGAGGUUCUG -63
Get sequence