MirGeneDB

Gene name

Aca-Mir-126-v1

Family name MIR-126 (all species)
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-126
Paralogues Aca-Mir-126-v2  Aca-Mir-126-v3 
Orthologues Ami-Mir-126-v1  Bta-Mir-126-v1  Cfa-Mir-126-v1  Cin-Mir-126-v1  Cli-Mir-126-v1  Cpi-Mir-126-v1  Cpo-Mir-126-v1  Dno-Mir-126-v1  Ete-Mir-126-v1  Gga-Mir-126-v1  Hsa-Mir-126-v1  Mdo-Mir-126-v1  Mml-Mir-126-v1  Mmu-Mir-126-v1  Oan-Mir-126-v1  Ocu-Mir-126-v1  Rno-Mir-126-v1  Sha-Mir-126-v1  Sto-Mir-126-v1  Tgu-Mir-126-v1  Xtr-Mir-126-v1 
Node of Origin (locus) Olfactores
Node of Origin (family) Olfactores
Genome context
(AnoCar2)
scaffold_2503.1-15445: 6937-6995 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-126-v1)
Mir-126-v2 scaffold_2503.1-15445: 6937-6995 [-] UCSC Ensembl
Mir-126-v3 scaffold_2503.1-15445: 6937-6995 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGAUGGACCCACUGCCGCUCCCCGCGGUCCAUUAUUACUUUUGGUACGCGCUGUGCCACUUCAAACUCGUACCGUGAGUAAUAAUGCGCUGAGGGACAGCACCCGCUGCAAACGCCGU
Get precursor sequence
Structure
        10         20         30        40        50         
GGGAUGGACCCACUGCC-   C-|  G    C           U       CGCUGUGCC 
                  GCU  CCC CGGU CAUUAUUACUU UGGUACG         \
                  CGA  GGG GUCG GUAAUAAUGAG GCCAUGC         A
UGCCGCAAACGUCGCCCA   CA^  A    C           U       UCAAACUUC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-126-v1_5p

MirBase accessionMIMAT0021730
Sequence
0- CAUUAUUACUUUUGGUACGCG -21
Get sequence
Seed sequenceAUUAUUA
Co-mature sequence

Aca-Mir-126-v1_3p

MirBase accessionMIMAT0021731
Sequence
38- CGUACCGUGAGUAAUAAUGCG -59
Get sequence
Seed sequenceGUACCGU