MirGeneDB

MirGeneDB ID

Aae-Mir-970

Family name MIR-970 (all species)
Seed CAUAAGA
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-970
Paralogues
Orthologues Dan-Mir-970  Dme-Mir-970  Dmo-Mir-970  Hme-Mir-970  Tca-Mir-970 
Node of Origin (locus) Endopterygota
Node of Origin (family) Endopterygota
Genome context
(Aaeg_L3)
supercont1.229: 1045835-1045895 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUAGUAACGGUAUUGCGGCUUUCAUAGGUAGCUUGCGUUUGUCUUAGCUGGUAUUGAAUGUGAUAGGUAUCAUAAGACACACGCGGCUAUUUUUGAGAGUAUCAAGCAUCUUGUAAAAAC
Get precursor sequence
Structure
        10          20        30        40        50        60 
UUUAGUAACGGUAUUGCG--|      U        U    U       GC     UUGAAU 
                    GCUUUCA AGGUAGCU GCGU UGUCUUA  UGGUA      G
                    UGAGAGU UUUAUCGG CGCA ACAGAAU  ACUAU      U
CAAAAAUGUUCUACGAACUA^      U        -    C       --     GGAUAG 
 .       110       100        90         80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-970_5p*

MirBase accessionNone
Sequence
0- AGCUUGCGUUUGUCUUAGCUGGUA -24
Get sequence
Mature sequence

Aae-Mir-970_3p

MirBase accessionMIMAT0014292
Sequence
40- UCAUAAGACACACGCGGCUAU -61
Get sequence