MirGeneDB

Gene name

Aae-Mir-67

Family name MIR-67 (all species)
MiRBase ID aae-mir-307
Paralogues
Orthologues Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cgi-Mir-67-P4  Cgi-Mir-67-P5  Cgi-Mir-67-P6  Cte-Mir-67  Dan-Mir-67-as  Dme-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Efe-Mir-67-P1  Efe-Mir-67-P2  Efe-Mir-67-P3  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67  Tca-Mir-67-v1  Tca-Mir-67-v2  Tca-Mir-67-v3 
Node of Origin (gene) Protostomia
Node of Origin (family) Protostomia
Genome context
(Aaeg_L3)
supercont1.16: 1859430-1859488 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGAUUGCACUAGUUUCCCGGCAGUCGAUCACUCACUCAACCUGGGUGUGAUGCUUAUUUGAAUCAUCACAACCUCCUUGAGUGAGCGACCGAUUGAUGGCGGGAUGUCUACAGAAGGA
Get precursor sequence
Structure
        10          20        30        40        50         
AGGAUUGCACUAGUUUC--|  G      A  A         CCU  G       CUUAU 
                   CCG CAGUCG UC CUCACUCAA   GG UGUGAUG     \
                   GGU GUUAGC AG GAGUGAGUU   CC ACACUAC     U
AGGAAGACAUCUGUAGGGC^  A      C  C         CCU  A       UAAGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-67_5p*

MirBase accessionNone
Sequence
0- ACUCACUCAACCUGGGUGUGAUG -23
Get sequence
Mature sequence

Aae-Mir-67_3p

MirBase accessionMIMAT0014296
Sequence
36- UCACAACCUCCUUGAGUGAGCGA -59
Get sequence
Seed sequenceCACAACC