MirGeneDB

Gene name

Aae-Mir-279-P2b2

Family name MIR-279 (all species)
MiRBase ID aae-mir-286b-2
Paralogues Aae-Mir-279-o26  Aae-Mir-279-P1  Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P3 
Orthologues Cgi-Mir-279  Dan-Mir-279-P2  Dme-Mir-279-P2  Dmo-Mir-279-P2  Dpu-Mir-279-o2  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (gene) A. aegypti
Node of Origin (family) Protostomia
Genome context
(Aaeg_L3)
supercont1.150: 907335-907413 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-P2b2)
Mir-2-P10b supercont1.150: 907506-907572 [+] UCSC Ensembl
Mir-3-P2a2 supercont1.150: 907891-907959 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAAGCCACACAAAGAAGUCCAAGUCCUGGGGCGAUUGUCGGCUUAGUCGCUGUAUCAUUUCAACUGCUGUGCAGUUCUUCGCUAGUGACUAGACCGAACACUCGUAUCCCAGGCCUUUACGGGACCAAGUUCGUCGUU
Get precursor sequence
Structure
        10         20        30           40        50        60        
CAAAGCCACACAAAGAA-  CC   U      --    U  -|   CU        GUAUCAUUUCAACUG 
                  GU  AAG CCUGGG  GCGA UG UCGG  UAGUCGCU               C
                  CA  UUC GGACCC  UGCU AC AGCC  AUCAGUGA               U
UUGCUGCUUGAACCAGGG  U-   C      UA    C  A^   AG        UCGCUUCUUGACGUG 
       130       120        110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-279-P2b2_5p*

MirBase accessionNone
Sequence
0- GGCGAUUGUCGGCUUAGUCGCU -22
Get sequence
Mature sequence

Aae-Mir-279-P2b2_3p

MirBase accessionMIMAT0014313
Sequence
56- UGACUAGACCGAACACUCGUAUC -79
Get sequence
Seed sequenceGACUAGA