MirGeneDB

Gene name

Aae-Mir-2-o57-v1

Family name MIR-2 (all species)
MiRBase ID aae-mir-2c
Paralogues Aae-Mir-2-o54  Aae-Mir-2-o55-v1  Aae-Mir-2-o56-v2  Aae-Mir-2-o57-v2  Aae-Mir-2-P4  Aae-Mir-2-P7  Aae-Mir-2-P8  Aae-Mir-2-P10a  Aae-Mir-2-P10b 
Orthologues
Node of Origin (gene) A. aegypti
Node of Origin (family) Protostomia
Genome context
(Aaeg_L3)
supercont1.268: 889091-889155 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-o57-v1)
Mir-2-o55-v1 supercont1.268: 887257-887317 [-] UCSC Ensembl
Mir-2-o56-v2 supercont1.268: 887257-887317 [-] UCSC Ensembl
Mir-2-o54 supercont1.268: 888597-888663 [-] UCSC Ensembl
Mir-2-P4 supercont1.268: 888744-888807 [-] UCSC Ensembl
Mir-2-o57-v2 supercont1.268: 889091-889155 [-] UCSC Ensembl
Mir-71 supercont1.268: 889383-889449 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAACUCACGCUGCUGAGUGGCAUGCGUUGGCAUCAAAUUUGGUUGUUUUAGUACGACCUCUUUGAAACCCCUAUCACAGCCAGCUUUGAUGAGCAACGCACCACUCAUACUCACGAAUGCUUCG
Get precursor sequence
Structure
        10           20        30         40        50        60  
GGAACUCACGCUGCUGA---|   CA       G-       U        UU   UACGACCUC 
                    GUGG  UGCGUUG  CAUCAAA UUGGUUGU  UAG         \
                    CACC  ACGCAAC  GUAGUUU GACCGACA  AUC         U
GCUUCGUAAGCACUCAUACU^   --       GA       C        CU   CCCAAAGUU 
   120       110         100        90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsNo
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-2-o57-v1_5p*

MirBase accessionNone
Sequence
0- GCAUCAAAUUUGGUUGUUUUAGU -23
Get sequence
Mature sequence

Aae-Mir-2-o57-v1_3p

MirBase accessionMIMAT0014308
Sequence
42- UAUCACAGCCAGCUUUGAUGAGC -65
Get sequence
Seed sequenceAUCACAG